Primary and secondary structure of hamster vimentin predicted from the nucleotide sequence.

نویسندگان
چکیده

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

the underlying structure of language proficiency and the proficiency level

هدف از انجام این تخقیق بررسی رابطه احتمالی بین سطح مهارت زبان خارجی (foreign language proficiency) و ساختار مهارت زبان خارجی بود. تعداد 314 زبان آموز مونث و مذکر که عمدتا دانشجویان رشته های زبان انگلیسی در سطوح کارشناسی و کارشناسی ارشد بودند در این تحقیق شرکت کردند. از لحاظ سطح مهارت زبان خارجی شرکت کنندگان بسیار با هم متفاوت بودند، (75 نفر سطح پیشرفته، 113 نفر سطح متوسط، 126 سطح مقدماتی). کلا ...

15 صفحه اول

Nucleotide Sequence and Secondary Structure Analysis

The nucleotide sequence of the 4.5 S ribosomal RNA from Spinacia oleracea chloroplast has been determined to be H~AGAGAAGGUCACGGCGAGACGAGCCGUUUAUCAUUAC GAUAGGUGUCAAGUGGAAGUGCAGUGAUGUAUGCAGCUGAGGCAUCCUAACAGACCCACAGAC WGAACoH using rapid gel sequencing techniques. This RNA contains 106 nucleotides including an AGA sequence at the 5’-end not found in other chloroplast 4.5 S RNAs and a seven-nucle...

متن کامل

Nucleotide sequence and secondary structure of apple scar skin viroid.

The complete nucleotide sequence of apple scar skin viroid(ASSV) has been established, and a probable secondary structure is proposed. A single-stranded circular ASSV RNA consists of 330 nucleotides and can assume the rodlike conformation with extensive base-pairing characteristic of all the known viroids. ASSV shows low sequence homologies with other viroids and lacks the central conserved reg...

متن کامل

Nucleotide sequence determination and secondary structure of Xenopus U3 snRNA.

Using a combination of RNA sequencing and construction of cDNA clones followed by DNA sequencing, we have determined the primary nucleotide sequence of U3 snRNA in Xenopus laevis and Xenopus borealis. This molecule has a length of 219 nucleotides. Alignment of the Xenopus sequences with U3 snRNA sequences from other organisms reveals three evolutionarily conserved blocks. We have probed the sec...

متن کامل

Primary and predicted secondary structures

Benoit GRANIER,* Colette DUEZ,* Sophie LEPAGE,* Serge ENGLEBERT,* Jean DUSART,*T Otto DIDEBERG,* Jozef VAN BEEUMEN,t Jean-Marie FRERE* and Jean-Marie GHUYSEN* *Centre d'Ingenierie des Proteines, Universite de Liege, Institut de Chimie, B6, B-4000 Sart Tilman (Liege 1), and tLaboratorium voor Microbiologie en Microbiele Genetica, Rijksuniversiteit-Gent, K.L. Ledeganckstraat 35, B-9000 Gent, Belgium

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: Proceedings of the National Academy of Sciences

سال: 1983

ISSN: 0027-8424,1091-6490

DOI: 10.1073/pnas.80.12.3548